Cancer Translational Medicine

Original Research | Open Access

Vol.9 (2023) | Issue-1 | Page No: 1-18

DOI: https://doi-ds.org/doilink/03.2023-55278827/A1

Potential role of CircMET as A Novel Diagnostic Biomarker of Papillary Thyroid Cancer

Yan Liu1,2,3,4#, Chen Cui1,2,3,4#, Jidong Liu1,2,3,4, Peng Lin1,2,3,4,Kai Liang1,2,3,4, Peng Su5, Xinguo Hou1,2,3,4, Chuan Wang1,2,3,4, Jinbo Liu1,2,3,4, Bo Chen6, Hong Lai1,2,3,4, Yujing Sun1,2,3,4* and Li Chen 1,2,3,4*

Affiliations  

1. Department of Endocrinology, Qilu Hospital of Shandong University, Jinan, Shandong, China

2. Institute of Endocrine and Metabolic Diseases of Shandong University, Jinan, Shandong, China

3. Key Laboratory of Endocrine and Metabolic Diseases, Shandong Province medicine & health, Jinan, Shandong, China

4. Jinan Clinical Research Center for Endocrine and Metabolic Diseases, Jinan, Shandong, China

5. Department of Pathology, Qilu Hospital of Shandong University, Jinan, Shandong, China

6. Department of Thyroid Surgery, Qilu Hospital of Shandong University, Jinan, Shandong, China

#These authors contributed equally to this work and should be considered as equal first coauthors.

*Corresponding Author

 

Address for correspondence: Prof. Li Chen, Department of Endocrinology, Qilu Hospital of Shandong University, No. 107 Wenhua West Road, Lixia District, Jinan 250012, Shandong, China. E-mail: chenli3@email.sdu.edu.cn

Dr. Yujing Sun, Department of Endocrinology, Qilu Hospital of Shandong University, No. 107 Wenhua West Road, Lixia District, Jinan 250012, Shandong, China. E-mail: sunyujing@qiluhospital.com


Important Dates  

Date of Submission:   12-Dec-2022

Date of Acceptance:   30-Jan-2023

Date of Publication:   31-Mar-2023

ABSTRACT

Aim: To study the circular RNAs (circRNAs) expression profiles and their potential role in the diagnosis and treatment of papillary thyroid cancer (PTC).

Methods: From June 2019 to July 2021, 68 patients diagnosed with PTC at Qilu Hospital were selected for the study. High-throughput sequencing determined the PTC and paired tissue samples' circRNAs expression profiles. Bioinformatics analyzed the differentially expressed circRNAs, miRNAs, and mRNAs. Upregulated circRNA expression levels were verified using qRT-PCR. GEPIA analyzed host gene expression and survival curves. circMET (hsa_circ_0082002) expression was confirmed by fluorescence in situ hybridization and qRT-PCR in the thyroid tissues and cell lines of PTC.

Results: Compared with benign thyroid tissues, 89 circRNAs were significantly upregulated and 14 were downregulated in PTC tissues (P<0.05). The network map identified 7 top upregulated circRNAs and their expressions were further verified using qRT-PCR. In addition, they were also highly expressed in other PTC patients. GEPIA showed that the host gene MET of circMET was significantly expressed in the PTC group compared with the control group (P<0.05). Silencing of circMET inhibited cell proliferation and disrupted the cell cycle in TPC-1 cells.

Conclusions: circMET may serve as a diagnostic or predictive biomarker of PTC and targeting circMET may be a promising therapeutic strategy.

Keywords: Papillary thyroid carcinoma, circular RNAs, high-throughput sequencing


INTRODUCTION

Thyroid cancer is the most common malignant tumor of the endocrine system. Among malignant tumors in women, thyroid cancer's incidence has increased at the quickest rate over the last 20 years.[1] Thyroid cancers account for approximately 1.5% to 2.1% of all cancers diagnosed annually worldwide.[2] According to the National Cancer Center, there were 6,800 thyroid cancer fatalities in China in 2015.[3] Papillary thyroid cancer (PTC) is the most common subtype compared to follicular and medullary types and has a high recurrence rate. PTC is generally associated with regional or distant lymph node metastasis, trachea invasion, bone metastasis, and brain metastasis,[4] and the incidence of distant cervical lymph node metastasis is as high as 90%.[5] Lymph node metastasis after surgical treatment in patients with PTC is independently and significantly negatively correlated with their survival. Early diagnosis and appropriate treatment can improve the outcomes and reduce the mortality of PTC patients.[6] Therefore, early diagnosis of PTC is a critical issue to be solved.

Circular RNAs (CircRNAs) are a kind of non-coding RNA (ncRNA) and are expressed in many biological cells. It has attracted the interest of researchers in recent years, primarily owing to its molecular and biological properties.[7] They are tissue-specific molecules produced by a special variable splicing mechanism. It has the characteristics of stable structure, conservation of sequence, and high specificity of cells or tissue. With the continuous development of sequencing technology, circRNAs have been found to play a key role in various biological processes through spongy microRNAs (miRNAs), regulating transcription or binding to proteins. Cancer has always been a kind of disease that seriously affects and disturbs human beings. It is becoming increasingly recognized that circRNAs are differentially expressed in cancer tissues and participate in the occurrence and development of tumors, which is expected to become a new molecular marker.[8] The expression profiles of circRNAs associated with PTC were identified, and the related bioregulatory networks were constructed using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis.[9] One study suggested that circ_0058124 is a potential molecular marker playing a role in the diagnosis and treatment of PTC.[10] However, the specific mechanism of action of circRNAs in PTC is still unknown, and the expression profiles of circRNAs and their roles in the development of PTC must be investigated further.

In this study, we evaluated the expression profiles of circRNAs in PTC and adjacent normal tissues using high-throughput RNA sequencing technology and validated the differentially expressed circRNAs by quantitative real-time polymerase chain reaction (qRT-PCR). Using gene enrichment and pathway analyses, we then looked at the relationship between circRNAs and messenger RNAs(mRNAs) as part of a potential circRNA-miRNA-mRNA regulatory axis related to PTC carcinogenesis and progression. The findings of the study shed light on the molecular events that happened during the development and prognosis of PTC.


MATERIALS AND METHODS

Patients’ information

From June 2019 to July 2021, we recruited 68 patients who underwent fine-needle aspiration biopsy (FNAB) at Qilu Hospital's Department of Endocrinology; This research was approved by the Ethics Committee of Qilu Hospital, Shandong University, with the approval number KYLL-2018(KS)-226. Written informed consent was obtained from all the patients participating in this study before they underwent FNAB.

A total of 33 patients were excluded because they did not have surgery, they withdrew, or their samples were unsuitable. After excluding an additional set of four failed samples, we obtained 31 pairs of PTC and adjacent normal tissues. High-throughput sequencing was performed on four PTCs and their adjacent normal tissues. Further validation was performed on the remaining 27 pairs of PTC and adjacent normal tissues. All samples were observed by two pathologists independently and identified as PTC. All FNAB samples were stored immediately with Total RNA Extraction Reagent (TRIzol) (Thermo Fisher Scientific, Waltham, MA, USA) and kept at 80°C until use. The experimental workflow analysis of FNAB samples is shown in Figure 1.

Figure 1.
Figure 1. Experimental workflow of high-throughput sequencing analysis of FNAB samples. The screening process for FNAB samples is depicted as a flowchart. The original sample was unfit for analysis due to a lack of tissues. The sample cancellation (n = 4) was caused by an unsuccessful RNA extraction.

Inclusion and exclusion criteria

The inclusion criteria were as follows: 1) All samples were confirmed as PTC by surgery and pathology; 2) No infection when FNAB in the biopsy location; 3) There were no other clotting abnormalities. The exclusion criteria were as follows: 1) Infection at the site of the puncture; 2) Severe bleeding disorders; 3) non-PTC organization type.

Hematoxylin and eosin staining

Tumor tissues were dissected and preserved in 4% PFA at 4°C for 24 h before being dehydrated with xylenes and alcohols and embedded in paraffin. For histological examination, sections were cut at 5 μm and stained with hematoxylin and eosin (HE). Images were captured using a Leica DM3000 microscope (Leica, Wetzlar, Germany).[11]

Immunofluorescence assay

Tissues were first fixed in 4% PFA for 20 min and then permeabilized with 0.2% Triton X-100 for 30 min. After being blocked with 5% goat serum for 2 h, cells were incubated with primary antibody rabbit polyclonal anti-Ki67 antibody (dilution 1:100; cat. no. TA314198, OriGene Technologies, Inc.) overnight at 4°C in a humidified chamber. Then, slices were washed using 1× PBS three times (5 min each) and incubated with secondary antibody goat anti-rabbit IgG H&L (Alexa Fluor® 594; dilution 1:300, cat. no ab150080, Abcam, Cambridge, MA, USA) for 2 h at room temperature. At last, DAPI (dilution:1:10,000; cat. no. D9542, Sigma-Aldrich, St. Louis, MO, USA) was used for nuclei staining. The images were taken with an Olympus IX81 microscope (Olympus Corporation, Tokyo, Japan).

Isolation of total RNA and quality control

RNA isolation was performed in an RNA-specific workspace at 4°C temperatures. Total RNA was purified from all samples using TRIzol (Thermo Fisher Scientific, Pudong, Shanghai, China). The RNA quality was measured by OD260/280 ratios and OD260/230 ratios using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). The total RNA concentration and quality were assessed for each sample. OD260/280 ratios between 1.8 and 2.1 were considered acceptable, and OD260/230 ratios greater than 1.8 were considered acceptable. RNA integrity and DNA contamination were then assessed using denaturing agar gel electrophoresis.

High-throughput sequencing analysis

Four pairs of PTC and paired tissues were used for high-throughput sequencing to investigate the differentially expressed circRNAs between cancer tissues and paracancerous tissues. Sequencing was performed by Shanghai Jing Zhou Gene Technology Co.; Ltd. RNA was sequenced on an Illumina Novaseq 6000 sequencer. The sequencing process was completely controlled by the data acquisition software provided by Illumina (San Diego, CA, USA), and the sequencing results were analyzed in real time. Differential expression analysis of circRNAs was performed using edgeR software. To obtain differentially expressed circRNAs, the screening conditions were set as the fold change of cancer tissues relative to the expression level of normal tissues ≥ 2 and P < 0.05.

CeRNA network construction and functional enrichment analysis

The regulatory network of miRNA sponge adsorption was established using regression model analysis and sequence matching based on gene expression values, and the core endogenous competitive RNAs (ceRNAs) were identified. We used Cytoscape 3.4.0 to construct a biological interaction network. We used this network to predict which microRNAs are bound by the differential circRNAs by analyzing the gene regulatory interactions and identifying the core regulatory genes.According to the location information of circRNA on the genome, the corresponding gene information can be obtained. The genes coding for the differential circRNAs were annotated using the Gene Ontology (GO) and KEGG (Kyoto Encyclopedia of Genes and Genomes, http://www.genome.ad.jp/kegg) databases.

Reverse transcription and quantitaive real-time PCR (qRT-PCR) validation

RNA was reverse transcribed to cDNA using EvoM-ML Reverse Transcription Kit II [AG11711, Accurate Biotechnology (Hunan) Co., Ltd], at 4°C according to the manufacturer’s instructions. A reaction solution volume of 20 µL was obtained. The reaction conditions were as follows: 37°C for 15 min followed by 85°C for 5 s, and then storage at 4°C. qRT-PCR was performed using the SYBR Green Pro Taq HS premixed qPCR kit (Takara, Japan) in a Light Cycler 480 System (Roche Diagnostics, Germany), with a 10 µL PCR reaction mixture including cDNA (1 µL). The reaction mixture was incubated in a Micro Amp TM Fast Optical 96-well reaction plate at 95°C for 5 min, followed by 35 cycles of 95°C (10 s), 60°C (30 s), and 72°C (30 s). Each experiment was repeated three times. The 2−∆∆Ct method was used to calculate the relative RNA expression levels. The expression levels of circRNAs were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The GAPDH and circRNAs primers sequences are listed in Table 1.

Table 1.
Table 1. Sequences of GAPDH and circRNA primers designed for RT-PCR amplification

Analysis of host genes expression and survival

Through the analysis of the relevant PTC data in the GEPIA platform for the Cancer Genome Atlas (TCGA) database (http://gepia.cancer-pku.cn), the significant differential expression and survival lines of host genes between the tumor and the control group were analyzed.

Fluorescence in situ hybridization (FISH)

CircMET probe was synthesized by the Suzhou Gemma Gene Co., Ltd. and used for the qualitative detection of circMET in the PTC tissues and cell lines. The circMET probe sequence was 5’ to 3’ (GGT + TTATCCTAT + TAAAGCAGTGCTCAGAGAGGT + TTA + TCC + TAT + TAAAGCAGTCAT + TATGAGAGGT + TTA + TCCTAT + TAA).

Cell transfection

Three PTC cancer cell lines—TPC-1, SW-579, and B-CPAP—and the benign human thyroid follicular cell line Nthy-ori 3-1 were purchased from the American Type Culture Collection (ATCC) and maintained in Roswell Park Memorial Institute (RPMI) modified medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/ streptomycin. Cell culture was performed at 37°C in a humidified CO2 incubator (5%). Cell identities were authenticated by short tandem repeat profiling and potential mycoplasma contamination was excluded by regular PCR methods. Exponential cells were used for all analyses. SiRNAs targeting the junction site of circMET were purchased from Suzhou Gemma Gene Co., Ltd [Table 2]. All oligonucleotides and vectors were transfected into the TPC-1 cell line using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA). After 24 h, their respective transfection efficiencies were tested by qRT-PCR.

Table 2.
Table 2. Sequences of SiRNAs targeting to the junction site of circMET

Cell proliferation and cell cycle analysis

Proliferation curves of PTC cell lines were determined by Cell Counting Kit‐8 (CCK‐8; Beyotime, Haimen, China) followed by the official directions. Specifically, the cells were cultured at 2 × 103 cells per well in triplicate in 96-well plates. After 0, 24, 48, and 72 h culturing, the OD value was detected at 450 nm after incubating the cells with CCK-8 reagent at 37°C for 2 h. Flow cytometric assay was carried out using Cell Cycle and Apoptosis Detection Kit (Meilune, Cat: MA0334, China) following the manufacturer's protocol (BD Biosciences, San Jose, CA).

Statistical analysis

GraphPad Prism 7.0 (GraphPad Software, San Diego, CA, USA) and SPSS version 21.0 software (SPSS Inc., Chicago, IL, USA) were used for statistical analysis. Continuous variables were expressed as mean ± standard deviation, and t-tests were performed to evaluate the differential expression of circRNAs between PTC and normal tissues. The average expression of circRNAs was used to define the low or high expression. P < 0.05 was considered to indicate statistical significance.


RESULTS

General clinicopathological characteristics of the patients

PTC tissue samples were collected by FNAB. The postoperative pathological analysis confirmed the results. The histomorphological characteristics of the PTC are shown in Supplementary Figures 1A and 1B. Table 3 demonstrates the clinicopathological characteristics of the patients. Of the enrolled patients, 25 were female. A pathologist classified all the samples as typical PTC with varying stages of tumor node metastasis. Six cases were multifocal, and 10 cases had a capsular invasion. The immunofluorescence staining of the PTC with Ki-67 and DAPI showed the proliferation characters of the PTC tissues [Supplementary Figure 1C].

Table 3.
Table 3. Participants’ clinicopathological characteristics (n = 31)

Analysis of circRNAs profiles

Based on pathology, we chose four pairs of samples for high-throughput sequencing. The heatmap [Figure 2A] and volcanic plot [Figure 2B] show the expression profiles of mRNAs in PTC and adjacent normal tissues. A total of 2,339 differentially expressed mRNAs (248 downregulated and 2,091 upregulated) were identified in PTC compared with normal tissues. The heatmap [Figure 2C] and scatter plot [Figure 2D] show the expression profiles of circRNAs in PTC and adjacent normal tissues. In PTC and adjacent thyroid tissues, a total of 5,835 circRNAs were identified. Among them, 103 circRNAs are differentially expressed, 14 of which were significantly downregulated and 89 of which were significantly upregulated in PTC.

CircRNA genes were distributed in nearly every human chromosome, including 22 autosomes and the sex chromosomes [Figure 2E]. The differentially expressed circRNAs were found primarily in exons, which accounted for approximately 94% of the total. We further screened out 14 significantly upregulated circRNAs. [Table 4].

Figure 2.
Figure 2. Identification of differentially expressed circRNAs. (A) Heatmap and (B) Volcano plot showing the differential expression of mRNAs in PTC and adjacent normal tissues. P < 0.05 and fold change (FC) ≥ 2. The red and blue colors indicate high and low expression, respectively. (C) Heatmap and (D) Scatter plot showing the differential expression of circRNAs in PTC and adjacent normal tissues. P < 0.05 and fold change (FC) ≥ 2. The red and blue colors indicate high and low expression, respectively. (E) Genomic coverage distribution of sample sequences and circRNA classification. The outermost circle represents the chromosome distribution, and each color inside the circle represents the coverage distribution of a sample sequence on the chromosome. The differentially expressed circRNAs are divided into three categories: exons, introns, and intergenic. The horizontal axis represents the different regions of the genetic element, and the ordinate represents the number of reads.

Table 4.
Table 4. Expression of the top 14 circRNAs in the PTC and paired adjacent tissues

The ceRNA network

We predicted potential miRNAs with differentially expressed circRNAs through sequence alignment [Supplementary Figure 2]. Then we constructed a circRNA and mRNA network to further study the interaction between circRNA and mRNA in PTC [Supplementary Digure 3]. Then, we built a circRNA-miRNA-mRNA network with the top 14 most significantly upregulated circRNAs [Figure 3A]. According to the putative binding site location in the circRNA sequence, the miRNA predicted by circMET are hsa-miR-6796-5p and hsa-miR-1197. We also found several potential axes in these ceRNA networks, namely circMET/hsa-miR-1197/B3GNT3, hsa-miR-6796-5p/CDH3, and circMCTP2/hsa-miR-1200 /MMP7.

Figure 3.
Figure 3. circRNA–miRNA–mRNA network map and biological analysis. (A) Fourteen upregulated circRNAs were used to construct the circRNA–miRNA–mRNA network. The network map contains (represented by red rectangles) downstream miRNAs (represented by blue triangles) and target mRNA (represented by a red oval). (B) Differential circRNA GO enrichment analysis of the first 30 biological processes. (C) Differential circRNA parental gene enrichment results of the first 30 pathways.

Enrichment analysis

We performed GO and KEGG pathway analyses on the circRNA genes. These were annotated by GO based on their biological process, cellular component, and molecular function. Genes were annotated to the cell (GO:0005623, P = 5.523E-01), protein binding (GO:0005515, P = 3.005E-03), response to stimulus (GO:0050896, P = 5.881E-05), and regulation of cellular process (GO:0050794, P = 6.073E-02) [Figure 3B]. We also enriched the host gene MET associated with the regulation of gene expression, metabolic process, and cellular process.

We used KEGG to analyze the genomic pathways of 30 closely related circRNA genes. Some critical pathways, such as cell adhesion molecules, focal adhesion, and ECM-receptor interactions, were enriched. These pathways are associated with tumor initiation, development, invasion, and metastasis [Figure 3C].

Q-RT-PCR validation of differentially expressed circRNAs

To validate these findings, we chose 7 top upregulated circRNAs in the PTC and adjacent tissues based on fold change values: circARHGAP5 (P < 0.0001), circMET (P < 0.0001), circMCTP2 (P < 0.0001), circSKIL (P < 0.0001), circPTK2 (P < 0.0001), circFNDC3B (P < 0.0001), and circMYO9A (P < 0.0001). The P value was <0.01, which was consistent with the trend in the sequencing results [Figure 4].

Figure 4.
Figure 4. Validation of differential circRNA expression in PTC and adjacent normal tissues. According to the high-throughput sequencing results, 7 circRNAs were identified, and 15 pairs of PTC and normal control tissues were used for qRT-PCR verification. The expression level of circRNAs in PTC was compared with that in normal tissues. Real-time quantitative reverse transcription PCR results were evaluated using the 2−∆ΔCT method, and the results were expressed as mean ± standard deviation (**P < 0.01).

Host gene expression analysis

Using the GEPIA platform analysis of the TCGA database, we examined the most critical genes based on the 7 circRNAs results, including fibronectin type III domain containing 3B (FNDC3B), SKI like proto‑oncogene (SKIL), multiple C2 and transmembrane domain containing 2 (MCTP2), MET proto-oncogene, receptor tyrosine kinase (MET), protein tyrosine kinase 2 (PTK2), myosin IXA (MYO9A) and Rho GTPase activating protein 5 (ARHGAP5). Only the differential expression of MET was found to be significant among the host genes of differentially expressed circRNA [Figure 5]. Then, we calculated overall survival (OS) rates based on the GEPIA software. In the TCGA database, PTC patients with higher FNDC3B and MYO9A expression had relatively low OS rates (hazards ratio HR =1.5 and 2.2, respectively) [Supplementary Figure 4A, 4F]. PTC patients with higher expression of MCTP2 and MET had relatively increased OS rates (HR = 0.54 and 0.52, respectively) [Supplementary 4C, 4D]. And the other genes expressed no change in the OS rates [Supplementary Figure 4B, 4E, 4G].

Figure 5.
Figure 5. Host gene expression level in PTC and adjacent normal tissues. (A-G) Overall analysis of host gene (ARHGAP5, FNDC3B, MCTP2, MET, MYO9A, PTK2, SKIL) expression level of patients with PTC by the Cancer Genome Atlas (TCGA) cohort.

Function analysis of the circMET in PTC patient tissues and cell lines

According to TCGA database analysis and the above results, we chose circMET as a promising circRNA. We confirmed that circMET expression was augmented in PTC tissues compared to non-cancer tissues through FISH [Figure 6A]. We used qRT-PCR to detect the circMET mRNA expression, and the results showed that in SW-579 (P = 0.0006), TPC-1 (P < 0.0001), and B-CPAP (P = 0.0028) cells line the circMET mRNA level was significantly higher than that in Nthy-ori3-1 cells line [Figure 6B] and selected the TPC-1 cell line for further study. Three siRNAs targeting the circMET junction site were designed, of which si-circRNA2 (P < 0.0001) and si-circRNA3 (P < 0.0001) were selected for further investigation because they have a higher silencing efficiency in TPC-1 cells compared with si-circRNA1 (P = 0.0023). The qRT-PCR and FISH results showed that the expression of circMET was significantly downregulated in the TPC1 cell line transfected with siRNA fragments and was localized in the cytoplasm of the protocell [Figure 6C, 6D].

In the proliferation experiment, we used the CCK-8 assay to conduct the growth curve. The CCK-8 results demonstrated that silencing of circMET significantly inhibited the proliferation of TPC-1 cells [Figure 6E] (24 h: P = 0.0028; 48 h: P < 0.0001; 72 h: P < 0.0001). The cell cycle analysis revealed that after silencing of circMET, TPC-1 cells distributed more in the G1 (P = 0.4922) and less in the S (P = 0.2800) and G2/M (P = 0.0006) phase, which indicated that TPC-1 cells were arrested in the S phase by silencing circMET [Figure 6F, 6G].

Figure 6.
Figure 6. Silencing of circMET affects cell proliferation and cell cycle. (A) Differential expression of circMET in PTC and normal tissues was analyzed by FISH. (B) The relative expression of circMET in each cell line was detected by qRT-PCR. (C) The expression of circMET in TPC1 cells transfected with si-circRNA and si-NC was analyzed by qRT-PCR. (D) circMET expression of si-NC and si-RNA2 add si-RNA3 in TPC1 cell line after transfection. (E) The growth curves of si-circ and si-NC cells were detected by the experimental method of CCK-8. (F-G) After F-G transfection of si-circRNA and si-NC, flow cytometry was used to analyze cell cycle progression. *P < 0.05, **P < 0.01, ***P < 0.001.


DISCUSSION

In recent years, an increasing number of studies have focused on circRNAs owing to their particular biological properties.[12] CircRNAs are highly stable and conservative ncRNAs with the classic ring structure and play an important role in the pathogenesis and development of various types of human cancer.[13],[14] Former studies have reported dysregulations in circRNA expression levels in several cancers, such as breast cancer,[15] cervical cancer,[16] and esophageal cancer.[17] Analysis of circRNA expression profiles in PTC based on microarray and RNA deep sequencing have been reported previously.[18],[19],[20] However, how circRNAs participate in PTC occurrence and development remains unknown and deserves further investigation.

Compared with the previous sequencing, we measured a greater number of differentially expressed circRNAs in PTC with strict threshold quality control, which allows us to explore the potential key circRNA that participates in PTC. Compared to normal tissues, 103 differentially expressed circRNAs and 2,339 differentially expressed mRNAs (FC > 2.0, P < 0.05) were determined in PTC, of which 89 circRNAs and 2,091 mRNAs were significantly upregulated, while 14 circRNAs and 248 mRNAs were significantly downregulated. The expression levels of circPSD3, circPSD3, circPTPRM, and circMET were recently reported to be upregulated in PTC, which is in line with our data.[20],[21] According to the report, the circPTK2/miR-758-3p/MYC axis promotes the proliferation of acute myeloid leukemia.[22] circPTK2 upregulates the CCL4-CCR5 axis through miR-125a-3p to promote the growth and invasion of lung adenocarcinoma.[23] The expression levels of circFN1, circFAM120B, circCCT4, and circRASSF2 were also reported to be upregulated in PTC and involved in promoting PTC progression but showed no significant difference in our results.[24],[25],[26],[27]

As circRNAs are transcribed from their host genes, we analyzed the host genes of the 7 top upregulated circRNAs. Then, we performed a functional cluster analysis of these host genes and circRNAs to predict the circRNAs’ function. To investigate the underlying mechanisms of circRNAs in PTC, we constructed a ceRNA network map of circRNA-miRNA-mRNA interactions for the 14 circRNAs that were most significantly upregulated and identified some pivotal miRNAs in the network. From the 14 upregulated circRNAs, we selected seven circRNAs for verification via qRT-PCR, and the results were in accordance with the sequencing results, which confirmed the reliability of the high-throughput sequencing results. Furthermore, we identified several circRNAs that had not been reported in previous studies. Therefore, our study plays an indispensable role in comprehensively studying and describing the differentially expressed circRNA and host genes in PTC. More importantly, MET, the host gene of circMET, showed statistical significance in the analysis among the circRNAs that we verified to be significantly differentially expressed. Previous studies have reported the upregulation of MET expression and the activation of the MET/PI3K/Akt signaling pathway which ultimately promotes the development of pancreatic ductal cancer cells.[15] And circMET drives immunosuppression and anti-PD1 therapy resistance in hepatocellular carcinoma via the miR-30-5p/Snail/DPP4 axis.[28] These previous studies found that circMET may influence the occurrence and progression of PTC via a series of circRNA-miRNA-mRNA regulation patterns.

To determine the role of circMET in the development and progression of PTC, further molecular biology experiments are required. According to the underlying mechanisms in thyroid carcinogenesis, DNA replication, and the cell cycle play important roles in PTC. Therefore, we conducted in vitro experiments and found that downregulated circMET by siRNAs could inhibit the proliferation of TPC-1 cells and regulate the cell cycle.

There are some limitations to this study. First, we only sequenced four pairs of control and PTC tissues, a dataset that is at high risk of bias due to the small sample size. Second, most of the samples were obtained from female patients with thyroid cancer. Therefore, unequal distribution of gender may cause a bias. Third, we did not fully investigate the role of circRNAs and miRNAs in the pathological process of PTC. The detailed mechanism of the molecular-molecular interaction remains unclear and requires further exploration in the future. Given the clinical utility of circRNAs, more research is needed to assess the diagnostic value of circRNAs in serum or FNAB samples. The regulatory mechanism of circRNAs in PTC occurrence and development is complex and should be further studied, and specific circRNAs should be identified.


CONCLUSIONS

This study discovered that 14 circRNAs are significantly upregulated in PTC compared with adjacent normal thyroid tissues. Among them, circMET was found to be potentially involved in the pathogenesis and progression of PTC by affecting cell proliferation and cell cycle. CircRNA-miRNA-mRNA interactions were predicted, and potential regulatory pathways were discussed in this analysis. Further functional validation could improve our understanding of the molecular mechanisms underlying PTC pathogenesis and progression and provide new ideas for PTC prevention and control.

 

ACKNOWLEDGMENT

We thank LetPub for its linguistic assistance during the preparation of this manuscript.

 

FINANCIAL SUPPORT AND SPONSORSHIP

This research was funded to Hong Lai by the Key Research and Development Plan of Shandong Province (No. 2019GSF108099), and Yujing Sun by Youth Foundation of Shandong Natural Science Foundation (No. ZR2021QC111).

 

CONFLICTS OF INTEREST

The authors declare no conflicts of interest.

 

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

The following information was supplied relating to ethical approvals: The Ethics Committee of Qilu Hospital, Shandong University, China (approval number: KYLL-2018(KS)-226). A written informed consent was obtained from all the patients participating in this study.

 

AUTHOR CONTRIBUTIONS

LC, YS designed the research study. CC and PS performed the research. XH, HL and BC collected clinical patient information. JL(Jidong Liu), CW and JL(Jinbo Liu) oversaw the patient sample collection and design. PS performed the histological examination of the thyroid. LC conceived the study and edited the manuscript. YL, PL and KL analyzed the data. YL wrote the manuscript. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript.

 

DATA AVAILABILITY

The following information was supplied regarding data availability: The sequences are available at GEO: GSE197443.


REFERENCES

 

1

Seib CD, Sosa JA. Evolving understanding of the epidemiology of thyroid cancer. Endocrinol Metab Clin North Am 2019; 48(1): 23-35.

2

Maniakas A, Davies L, Zafereo ME. Thyroid disease around the world. Otolaryngol Clin North Am 2018; 51(3): 631-42.

3

Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, Yu XQ, He J. Cancer statistics in China, 2015. CA Cancer J Clin 2016; 66(2): 115-32.

4

Wang TS, Sosa JA. Thyroid surgery for differentiated thyroid cancer - recent advances and future directions. Nat Rev Endocrinol 2018; 14(11): 670-83.

5

Lim H, Devesa SS, Sosa JA, Check D, Kitahara CM. Trends in Thyroid Cancer Incidence and Mortality in the United States, 1974-2013. JAMA 2017; 317(13): 1338-48.

6

Nguyen QT, Lee EJ, Huang MG, Park YI, Khullar A, Plodkowski RA. Diagnosis and treatment of patients with thyroid cancer. Am Health Drug Benefits 2015; 8(1): 30-40.

7

Guo X, Tan W, Wang C. The emerging roles of exosomal circRNAs in diseases. Clin Transl Oncol 2021; 23(6): 1020-33.

8

Liu B, Dong C, Chen Q, Fan Z, Zhang Y, Wu Y, Cui T, Liu F. Circ_0007534 as new emerging target in cancer: Biological functions and molecular interactions. Front Oncol 2022; 12: 1031802.

9

Lan X, Xu J, Chen C, Zheng C, Wang J, Cao J, Zhu X, Ge M. The landscape of circular RNA expression profiles in papillary thyroid carcinoma based on RNA sequencing. Cell Physiol Biochem 2018; 47(3): 1122-32.

10

Liu L, Yan C, Tao S, Wang H. Circ_0058124 Aggravates the Progression of Papillary Thyroid Carcinoma by Activating LMO4 Expression via Targeting miR-370-3p. Cancer Manag Res 2020; 12: 9459-70.

11

Zhang DL, Sun YJ, Ma ML, Wang YJ, Lin H, Li RR, Liang ZL, Gao Y, Yang Z, He DF, Lin A, Mo H, Lu YJ, Li MJ, Kong W, Chung KY, Yi F, Li JY, Qin YY, Li J, Thomsen ARB, Kahsai AW, Chen ZJ, Xu ZG, Liu M, Li D, Yu X, Sun JP. Gq activity- and β-arrestin-1 scaffolding-mediated ADGRG2/CFTR coupling are required for male fertility. Elife 2018; 7: e33432.

12

Bai H, Lei K, Huang F, Jiang Z, Zhou X. Exo-circRNAs: a new paradigm for anticancer therapy. Mol Cancer 2019; 18(1): 56.

13

Ma S, Kong S, Wang F, Ju S. CircRNAs: biogenesis, functions, and role in drug-resistant Tumours. Mol Cancer 2020; 19(1): 119.

14

Tang Q, Hann SS. Biological roles and mechanisms of Circular RNA in human cancers. Onco Targets Ther 2020; 13: 2067-92.

15

Smid M, Wilting SM, Uhr K, Rodríguez-González FG, De Weerd V, Prager-Van Der Smissen WJC, Van Der Vlugt-Daane M, Van Galen A, Nik-Zainal S, Butler A, Martin S, Davies HR, Staaf J, Van De Vijver MJ, Richardson AL, Macgrogan G, Salgado R, Van Den Eynden GGGM, Purdie CA, Thompson AM, Caldas C, Span PN, Sweep FCGJ, Simpson PT, Lakhani SR, Van Laere S, Desmedt C, Paradiso A, Eyfjord J, Broeks A, Vincent-Salomon A, Futreal AP, Knappskog S, King T, Viari A, Børresen-Dale A-L, Stunnenberg HG, Stratton M, Foekens JA, Sieuwerts AM, Martens JWM. The circular RNome of primary breast cancer. Genome Res 2019; 29(3): 356-66.

16

Chaichian S, Shafabakhsh R, Mirhashemi SM, Moazzami B, Asemi Z. Circular RNAs: A novel biomarker for cervical cancer. J Cell Physiol 2020; 235(2): 718-24.

17

Luo B, Tang CM, Chen JS. circRNA and gastrointestinal cancer. J Cell Biochem 2019; 120(7): 10956-63.

18

Ren H, Liu Z, Liu S, Zhou X, Wang H, Xu J, Wang D, Yuan G. Profile and clinical implication of circular RNAs in human papillary thyroid carcinoma. PeerJ 2018; 6: e5363.

19

Peng N, Shi L, Zhang Q, Hu Y, Wang N, Ye H. Microarray profiling of circular RNAs in human papillary thyroid carcinoma. PLoS One 2017; 12(3): e0170287.

20

Lv C, Sun W, Huang J, Qin Y, Ji X, Zhang H. Expression profiles of circular RNAs in human papillary thyroid carcinoma based on RNA deep sequencing. Onco Targets Ther 2021; 14: 3821-32.

21

Jin X, Wang Z, Pang W, Zhou J, Liang Y, Yang J, Yang L, Zhang Q. Upregulated hsa_circ_0004458 contributes to progression of papillary thyroid carcinoma by inhibition of miR-885-5p and activation of RAC1. Med Sci Monit 2018; 24: 5488-500.

22

Xiao Y, Ming X, Wu J. Hsa_circ_0002483 regulates miR‐758‐3p/MYC axis to promote acute myeloid leukemia progression. Hematol Oncol 2021; 39(2): 243-53.

23

Wan J, Ding G, Zhou M, Ling X, Rao Z. Circular RNA hsa_circ_0002483 promotes growth and invasion of lung adenocarcinoma by sponging miR-125a-3p. Cancer Cell Int 2021; 21(1): 533.

24

Shi E, Ye J, Zhang R, Ye S, Zhang S, Wang Y, Cao Y, Dai W. A combination of circRNAs as a diagnostic tool for discrimination of papillary thyroid cancer. Onco Targets Ther 2020; 13: 4365-72.

25

Qi Y, He J, Zhang Y, Wang L, Yu Y, Yao B, Tian Z. Circular RNA hsa_circ_0001666 sponges miR‑330‑5p, miR‑193a‑5p and miR‑326, and promotes papillary thyroid carcinoma progression via upregulation of ETV4. Oncol Rep 2021; 45(4): 50.

26

Luo Q, Guo F, Fu Q, Sui G. hsa_circ_0001018 promotes papillary thyroid cancer by facilitating cell survival, invasion, G(1)/S cell cycle progression, and repressing cell apoptosis via crosstalk with miR-338-3p and SOX4. Mol Ther Nucleic Acids 2021; 24: 591-609.

27

Li Z, Xu J, Guan H, Lai J, Yang X, Ma J. Circ_0059354 aggravates the progression of papillary thyroid carcinoma by elevating ARFGEF1 through sponging miR-766-3p. J Endocrinol Invest 2022; 45(4): 825-36.

28

Huang XY, Zhang PF, Wei CY, Peng R, Lu JC, Gao C, Cai JB, Yang X, Fan J, Ke AW, Zhou J, Shi GM. Circular RNA circMET drives immunosuppression and anti-PD1 therapy resistance in hepatocellular carcinoma via the miR-30-5p/snail/DPP4 axis. Mol Cancer 2020; 19(1): 92.

COPYRIGHT AND LICENSE INFORMATION

This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution‑NonCommercial‑ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non‑commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.

For reprints contact: info@plascipub.com

DISCLAIMER

All claims made in this article are exclusively those of the writers, and do not necessarily reflect the views of their connected organizations, the publisher, editors, or reviewers. The publication does not guarantee or promote any product that may be evaluated in this article or any claim made by its producer.


Supplementary Figures

Supplemental figure 1.
Supplemental figure 1. Thyroid immunohistochemical and fluorescent dye staining Images of representative H&E staining: (A) FNAB PTC sample, (B) PTC tissue sample and adjacent normal tissue sample, and (C) PTC fluorescent staining. Amplification factor: 40×, 200×.

Supplemental figure 2.
Supplemental figure 2. Construction of the circRNA–miRNA interaction network We constructed of the circRNA–miRNA interaction network and predicted the relationship of 500 top circRNAs (represented by blue) to miRNAs (represented by red).

Supplemental figure 3.
Supplemental figure 3. circRNA–mRNA co-expression network map analysis We do the circRNA–mRNA co-expression network map analysis and there were 500 top circRNAs (green dots) and target mRNAs (red dots).

Supplemental figure 4.
Supplemental figure 4. Survival analysis of the host genes of the main differential circRNAs expressed in PTC patients. (A-G) Overall survival analysis of patients with PTC by FNDC3B, SKIL, MCTP2, MET, PTK2, MYO9A and ARHGAP5 in The Cancer Genome Atlas (TCGA) cohort.


Related Articles

TRAF Proteins In NSCLC: Analysis Of Data From The Public Database And Literature Review

Xuebing Li1, Yaguang Fan1, Hongli Pan1, Yang Li1, Limin Cao1, Zhenhua Pan1, Lingling Zu1, Fanrong Meng2, Mengjie Li3, Qinghua Zhou1, Xuexia Zhou4*

 


Research Progress of Cytokines and Their Receptors in Ovarian Cancer

Yuanwen Zhang1, Zhouman He1, Shiyun Liang1, Jian Yuan1, Huihui Ti1 *

 

 


Contribution Of Human Endogenous Retroviruses To Metastasis Of Solid Tumors

Nianbin Li1, Jing Wang2, Yaguang Fan2, Min Wang2, Chen Chen2, Ting Wang1*, Heng Wu2*

 

 


Role of PD-1/PD-L1 Inhibitors in the Treatment of Metastatic Lung Cancer

Yufei Chen1, Mei Zhong2, Zhenhua Pan2, Jun Chen2, Hongli Chen2, Fengjie Guo2, 3,*

 

 


Cytochrome P450 2C19 Polymorphisms are Associated with a High Risk of Esophageal Squamous Cell Carcinoma in Asian Populations: A Systematic Review and Meta-Analysis

Xuehan Gao1, Zhihong Qian2, Guige Wang1, Lei Liu1, Jiaqi Zhang1, Ke Zhao1, Mengxin Zhou1, Shanqing Li1*


Limb Arterial Embolism secondary to Myocardial Primary Light Chain Amyloidosis – A Case Report

Lei Ji1, Zhili Liu1, Yuehong Zheng1*


In situ Laser Fenestration to Reconstruct Three Supra Arch Branches for Recurrent Aortic Dissection after Replacement of the Ascending Aorta and Implantation of Stent Graft in the Descending Aorta: A Case Report

Li Yuan Niu1, Hai Xin1, Hao Fu Wang1*, Yue Wei Wang1*


Research progress in traditional Chinese medicine for the treatment of androgenic alopecia

Weiwei LI1, Chenghao Zhu2, Dandan Yang3, Yanhua YI1, Shuncai Liu1, Zhenyu Gong1*


Isolated Abdominal Wall Metastasis without Definitive Primary Lesion after Laparoscopic Cholecystectomy: A Case Report

La Zhang1, Ning Jiang2, Rui Liao1, Baoyong Zhou1*, Dewei Li3*


Analysis of Immune-Related Genes in the Tumor Microenvironment of Bladder Cancer based on TCGA database

Haiyang Jiang1#, Longguo Dai1#, Huijian Wang1#, Chongjian Zhang1, Yu Bai1, Ruiqian Li1, Jun Li1, Chen Hu1, Hongyi Wu1, Hong Yang1, Qilin Wang1, Pingting Chen2*


Diagnostic Biomarkers in Cerebrospinal Fluid in Primary Central Nervous System Lymphoma: A Protocol for Systematic Review and Meta-analysis

Lili Zhou1,2, Hai Yi1*, Dan Chen1, Qian Zhang1, Fangyi Fan1, Ling Qiu1, Nan Zhang1, Yi Su1


Updates on Molecular Markers for Gliomas

Jingyao Jie1, Weijuan Zhang2*


Peroxisome Proliferator-Activated Receptor-γ Agonists as New Targets of Lung Cancer Therapy

Shixiong Wei1*


Microcirculation Specialist Consensus on Diagnosis and Treatment of Superficial Varicose Veins of Lower Limbs

Wang Lei1, Zheng Yuehong1*


Anticoagulation might not be necessary for asymptomatic central venous catheter-related thrombosis in adults

Wei Zhang1, Zhi Xiang1, Qin Ma2, Chuanlin Zhang3, Yu Zhao1, Qining Fu1*


The Roles of microRNA in the Diagnosis and Prognosis of Papillary Thyroid Cancer

Jingya Gao1*, Li Liu2*


Lung Cancer Tumor Microenvironment: An Update on Recent Advances in Research

Guangda Yuan1, Bowen Hu1, Yong Yang1*


Quantified ADC Values and Attenuation Trends for Diagnosing Prostate Cancer with Multiple b Values MRI

Jing Hu1#, Jingying Bu1#,Zhe Wang2#, Zhengdan Su2, Xiaoxian Wang2, Haiyao Pi3, Diliang Li2, Zhaoyang Pu4, Xin Tian1*


Differential Expression of T-box Transcription Factor TBX19 Regulates the Progression of Hepatocellular Carcinoma

Guifang He1, Yanjiao Hu2, Fuguo Dong3, Changchang Liu1, Duo Cai1, Shihai Liu1*


Advances in Pathogenesis and Non-surgical Therapy of Cutaneous Basal Cell Carcinoma

Yichen Wu1, Jia Chen2*


Quercetin Inhibits the Proliferation and Migration of Pancreatic Adenocarcinoma by Targeting the Prognostic-related Gene MMP1 via Bioinformatics and Network Pharmacology

Zhenhua Zu1,2#, Zhongguo Zhu3#, Zhiyu Xia2, Hongrang Chen1*, Yongsheng Li1*


Huge Lung Fibroleiomyomatous Hamartoma in the Pleural Cavity – A Case report

Minghui Liu1#, Xin Li1#, Hongbing Zhang1, Fan Ren1, Ming Dong1, Chunqiu Xia1, Jun Chen1,2*


Increased Expression of IL-17A, IL-6, STAT3, TGF-β, and VEGF: Potential Biomarkers in Bladder Cancer?

Zishen Xiao1, Chengxia Bai1, Teng Zhao1, Jiayu Lin1, Lijuan Yang1, Jian Liu2, Zhenjiang Wang1, Ying Sun3,4, Yanbo Liu1*


Identification of NSD2 as a Potential Diagnostic and Prognostic Biomarker for Hepatocellular Carcinoma

Wei Zhao1#, Xinyu Xiao1#, Yu Gao1,2, Shanshan Liu3, Xiuzhen Zhang1, Changhong Yang1, Qiling Peng1, Ning Jiang2*, Jianwei Wang1*


Quercetin Inhibits Glioma Proliferation by Targeting CDK1 and CCNB1 - Bioinformatics and Network Pharmacology

Huaixu Li1#, Peng Gao1#, Haotian Tian1, Zhenyu Han2, Xingliang Dai1*, Hongwei Cheng1*


Selective Internal Radiation Therapy with Yttrium-90 Microspheres in Hepatocellular Carcinoma – Applications and recent advances

Wei Wang1, Dawei Xie1, Bing Li1, Minghao Chen1*


Irreversible Electroporation in Pancreatic Cancer – Applications and recent advances

Yuanyuan Sun1, Qian Li2, Jia Hu2, Yanfang Liu2*, Xiaosong Li2*


Prognostic Value of Bismuth Typing and Modified T‑stage in Hilar Cholangiocarcinoma

Shengen Yi, Xiongjian Cui, Li Xiong, Xiaofeng Deng, Dongni Pei, Yu Wen, Xiongying Miao


MicroRNAs are Related to Rituximab in Combination with Cyclophosphamide, Doxorubicin, Vincristine, and Prednisone Resistance in Patients with Diffuse Large B-cell Lymphoma

Haibo Huang1, Junjiao Gu1, Shuna Yao1, Zhihua Yao1, Yan Zhao1, Qingxin Xia2, Jie Ma2, Ling Mai3, Shujun Yang1, Yanyan Liu1


Comparison of Intra-voxel Incoherent Motion Diffusion Magnetic Resonance Imaging and Apparent Diffusion Coefficient in the Evaluation of Focal Malignant Liver Masses

Jinrong Qu1, Xiang Li1, Lei Qin2, Lifeng Wang1, Junpeng Luo1, Jianwei Zhang1, Hongkai Zhang1, Jing Li1, Fei Sun3, Shouning Zhang1, Yanle Li1, Cuicui Liu1, Hailiang Li1


Extracting Breathing Signal Using Fourier Transform from Cine Magnetic Resonance Imaging

Jing Cai1,2, Yilin Liu2, Fangfang Yin1,2


Split End Family RNA Binding Proteins: Novel Tumor Suppressors Coupling Transcriptional Regulation with RNA Processing

Hairui Su1, Yanyan Liu2, Xinyang Zhao1


Thioredoxin-interacting Protein as a Common Regulation Target for Multiple Drugs in Clinical Therapy/Application

Pengxing  Zhang1, Xiaoling Pang2,3, Yanyang Tu1,4


Associations of Age and Chemotherapy with Late Skin and Subcutaneous Tissue Toxicity in a Hypofractionated Adjuvant Radiation Therapy Schedule in Post‑mastectomy Breast Cancer Patients

Mohammad Akram1, Ghufran Nahid1, Shahid Ali Siddiqui1, Ruquiya Afrose2


Monitoring of Disease Activity in Chronic Myeloid Leukemia‑chronic Phase Patients Treated with Indian Generic Veenat (NATCO) Imatinib Mesylate: A Tertiary Care Experience

Khushboo Dewan, Tathagat Chatterjee


Review of Cancer Immunotherapy: Application of Chimeric Antigen Receptor T Cells and Programmed Death 1/Programmed Death‑ligand 1 Antibodies

Tengfei Zhang1,2, Ling Cao1, Zhen Zhang1, Dongli Yue1, Yu Ping1, Hong Li1, Lan Huang1, Yi Zhang1,3,4,5


Systematic Review of MicroRNAs and its Therapeutic Potential in Glioma

Nan Liu1, Yanyang Tu2


The Involvement of p53‑miR‑34a‑CDK4 Signaling During the Development of Cervical Cancer

Huijun Zuo, Jieqi Xiong, Hongwei Chen, Sisun Liu, Qiaoying Gong, Fei Guo


Unusual Clinical Presentation of a Rare Type of Breast Malignancy: A Case Report and a Short Review of Literature

Nadeesha J. Nawarathna1, Navam R. Kumarasinghe1, Palitha Rathnayake2,
Ranjith J. K. Seneviratne1


Sweet’s Syndrome in Acute Lymphoblastic Leukemia with t (9:22)

Khushboo Dewan, Shailaja Shukla


Analysis of the Correlationship between Prostate Specific Antigen Related Variables and Risk Factor in Patients with Prostate Carcinoma

Daoyuan Wang1, Tiejun Yang2, Yongqiang Zou1, Xinqiang Yang1


Recent Progress in Genetic and Epigenetic Profile of Diffuse Gastric Cancer

Zhengxi He1, Bin Li1,2


Strategies for Management of Spinal Metastases: A Comprehensive Review

Zhantao Deng, Bin Xu, Jiewen Jin, Jianning Zhao, Haidong Xu


Application and Perspectives of Traditional Chinese Medicine in the Treatment of Liver Cancer

Xia Mao, Yanqiong Zhang, Na Lin


Primary Hepatic Carcinoid Tumor: A Case Report and Literature Review

Yupeng Lei1, Hongxia Chen2, Pi Liu1, Xiaodong Zhou1


Expression Characteristics of miR‑10b in Nasopharyngeal Carcinoma

Gang Li, Yunteng Zhao, Jianqi Wang, Haoran Huang, Mengwen Zhang


An Update on Immunohistochemistry in Translational Cancer Research

Zonggao Shi, M. Sharon Stack


Promoter Methylated Tumor Suppressor Genes in Glioma

Yingduan Cheng1, Yanyang Tu2, Pei Liang3


Palliative Treatment of Malignant Pleural Effusion

Chenyang Liu1*, Qian Qian2*, Shen Geng1, Wenkui Sun1, Yi Shi1


Functional Perspective and Implications of Gene Expression by Noncoding RNAs

Xiaoshuang Yan1, Huanyu Xu2, Zhonghai Yan3


Expression of E3 Ubiquitin Ligases in Multiple Myeloma Patients after Treatment with the Proteasome Inhibitor Bortezomib

James Joseph Driscoll


miR‑505 Downregulates 6‑Phosphofructo‑2‑Kinase/ Fructose‑2,6‑Biphosphatase 4 to Promote Cell Death in Glioblastoma

Esther H. Chung, Hongwei Yang, Hongyan Xing, Rona S. Carroll, Mark D. Johnson


Utility of Fine Needle Aspiration Cytology in Diagnosing Bone Tumors

Sonal Mahajan1, Akash Arvind Saoji2, Anil Agrawal1


Histone H2A and H2B Deubiquitinase in Developmental Disease and Cancer

Demeng Chen1, Caifeng Dai2, Yizhou Jiang3


Genetic Characteristics of Glioblastoma: Clinical Implications of Heterogeneity

Qian Li1, Yanyang Tu1,2


Acute Lymphoblastic Leukemia with Normal Platelet Count

Khushboo Dewan, Kiran Agarwal


Galanin is a Novel Epigenetic Silenced Functional Tumor Suppressor in Renal Cell Carcinoma

Shengkun Sun1*, Axiang Xu1*, Guoqiang Yang1, Yingduan Cheng2

 


Selenium Dioxide Induced Apoptosis in Cervical Cancer Cells via Regulating Apoptosis-related Let-7a MicroRNA and Proteins

Sisun Liu1, Jieqi Xiong2, Ling Guo3, Min Xiu1,4, Feng He1,4, Yuanlei Lou5, Fei Guo6,7


Low Expression of Polo‑like Kinase 1 is Associated with Poor Prognosis in Liver Cancer

Weixia Li1, Kunpeng Liu1, Dechen Lin2, Xin Xu2, Haizhen Lu3, Xinyu Bi4, Mingrong Wang2


Extracorporeal Photopheresis for Steroid‑refractory Chronic Graft‑versus‑host Disease After Allogeneic Hematopoietic Stem Cell Transplantation: A Systematic Review and Meta‑Analysis

Runzhe Chen1, Baoan Chen1, Peter Dreger2, Michael Schmitt2, Anita Schmitt2


Glucans and Cancer: Historical Perspective

Petr Sima1, Luca Vannucci1, Vaclav Vetvicka2


Implications of Circadian Rhythm Regulation by microRNAs in Colorectal Cancer

Song Wu1, Andrew Fesler2, Jingfang Ju2


BCL2 Family, Mitochondrial Apoptosis, and Beyond

Haiming Dai1, X. Wei Meng2, Scott H. Kaufmann2


Quantum Dot‑based Immunohistochemistry for Pathological Applications

Li Zhou1, Jingzhe Yan2, Lingxia Tong3, Xuezhe Han4, Xuefeng Wu5, Peng Guo6


CD24 as a Molecular Marker in Ovarian Cancer: A Literature Review

Lu Huang1, Weiguo Lv2, Xiaofeng Zhao1


Etiological Trends in Oral Squamous Cell Carcinoma: A Retrospective Institutional Study

Varsha Salian, Chethana Dinakar, Pushparaja Shetty, Vidya Ajila


Effect of Irinotecan Combined with Cetuximab on Liver Function in Patients with Advanced Colorectal Cancer with Liver Metastases

Yan Liang1, Yang Li2, Xin Li3, Jianfu Zhao4


The Role of Precision Medicine in Pancreatic Cancer: Challenges for Targeted Therapy, Immune Modulating Treatment, Early Detection, and Less Invasive Operations

Khaled Kyle Wong1, Zhirong Qian2, Yi Le3


Targeting Signal Transducer and Activator of Transcription 3 for Colorectal Cancer Prevention and Treatment with Natural Products

Weidong Li1,2*, Cihui Chen3*, Zheng Liu2, Baojin Hua1


The Potential of Wnt Signaling Pathway in Cancer: A Focus on Breast Cancer

Mahnaz M. Kazi, Trupti I. Trivedi, Toral P. Kobawala, Nandita R. Ghosh


Imaging‑driven Digital Biomarkers

Enrico Capobianco


Target‑Matching Accuracy in Stereotactic Body Radiation Therapy of Lung Cancer: An Investigation Based on Four‑Dimensional Digital Human Phantom

Jing Cai1,2, Kate Turner2, Xiao Liang2, W. Paul Segars2,3, Chris R. Kelsey1, David Yoo1, Lei Ren1,2, Fang‑Fang Yin1,2


Downregulation of Death‑associated Protein Kinase 3 and Caspase‑3 Correlate to the Progression and Poor Prognosis of Gliomas

Ye Song, Tianshi Que, Hao Long, Xi’an Zhang, Luxiong Fang, Zhiyong Li, Songtao Qi


Hyaluronic Acid in Normal and Neoplastic Colorectal Tissue: Electrospray Ionization Mass Spectrometric and Fluor Metric Analysis

Ana Paula Cleto Marolla1, Jaques Waisberg2, Gabriela Tognini Saba2, Demétrius Eduardo Germini2, Maria Aparecida da Silva Pinhal1


Melanoma Antigen Gene Family in the Cancer Immunotherapy

Fengyu Zhu1, Yu Liang1, Demeng Chen2, Yang Li1


Combined Chronic Lymphocytic Leukemia and Pancreatic Neuroendocrine Carcinoma: A Collision Tumor Variation

Kaijun Huang1, Panagiotis J. Vlachostergios1, Wanhua Yang2, Rajeev L. Balmiki3


Antiproliferative and Apoptotic Effect of Pleurotus ostreatus on Human Mammary Carcinoma Cell Line (Michigan Cancer Foundation‑7)

Krishnamoorthy Deepalakshmi, Sankaran Mirunalini


Impact of Age on the Biochemical Failure and Androgen Suppression after Radical Prostatectomy for Prostate Cancer in Chilean Men

Nigel P. Murray1,2, Eduardo Reyes1,3, Nelson Orellana1, Cynthia Fuentealba1, Omar Jacob1


Carcinoma of Unknown Primary: 35 Years of a Single Institution’s Experience

Rana I. Mahmood1,2, Mohammed Aldehaim1,3, Fazal Hussain4, Tusneem A. Elhassan4,
Zubeir A. Khan5, Muhammad A. Memon6


Metformin in Ovarian Cancer Therapy: A Discussion

Yeling Ouyang1, Xi Chen2, Chunyun Zhang1, Vichitra Bunyamanop1, Jianfeng Guo3


The Progress in Molecular Biomarkers of Gliomas

Jing Qi1, Hongwei Yang2, Xin Wang2, Yanyang Tu1


Correlation between Paclitaxel Tc > 0.05 and its Therapeutic Efficacy and Severe Toxicities in Ovarian Cancer Patients

Shuyao Zhang1*, Muyin Sun2*, Yun Yuan3*, Miaojun Wang4*, Yuqi She1*, Li Zhou5, Congzhu Li5, Chen Chen1, Shengqi Zhang4


Identifying Gaps and Relative Opportunities for Discovering Membrane Proteomic Biomarkers of Triple‑negative Breast Cancer as a Translational Priority

Bhooma Venkatraman


The Molecular Mechanism and Regulatory Pathways of Cancer Stem Cells

Zhen Wang1, Hongwei Yang2, Xin Wang2, Liang Wang3, Yingduan Cheng4, Yongsheng Zhang5, Yanyang Tu1,2


Nanoparticle Drug Delivery Systems and Three‑dimensional Cell Cultures in Cancer Treatments and Research

Wenjin Shi1, Ding Weng2,3, Wanting Niu2,3


Choline Kinase Inhibitors Synergize with TRAIL in the Treatment of Colorectal Tumors and Overcomes TRAIL Resistance

Juan Carlos Lacal1, Ladislav Andera2


MicroRNA Regulating Metabolic Reprogramming in Tumor Cells: New Tumor Markers

Daniel Otero‑Albiol, Blanca Felipe‑Abrio


Biomarkers of Colorectal Cancer: A Genome‑wide Perspective

José M. Santos‑Pereira1, Sandra Muñoz‑Galván2


Nicotinamide Adenine Dinucleotide+ Metabolism Biomarkers in Malignant Gliomas

Manuel P. Jiménez‑García, Eva M. Verdugo‑Sivianes, Antonio Lucena‑Cacace


Patient-derived Xenografts as Models for Personalized Medicine Research in Cancer

Marco Perez, Lola Navas, Amancio Carnero


Genome‑wide Transcriptome Analysis of Prostate Cancer Tissue Identified Overexpression of Specific Members of the Human Endogenous Retrovirus‑K Family

Behnam Sayanjali1,2


Clinical Utility of Interleukin‑18 in Breast Cancer Patients: A Pilot Study

Reecha A. Parikh, Toral P. Kobawala, Trupti I. Trivedi, Mahnaz M. Kazi, Nandita R. Ghosh


Current and Future Systemic Treatment Options for Advanced Soft‑tissue Sarcoma beyond Anthracyclines and Ifosfamide

Nadia Hindi1,2, Javier Martin‑Broto1,2


The Genomic Organization and Function of IRX1 in Tumorigenesis and Development

Pengxing Zhang1, Hongwei Yang2, Xin Wang2, Liang Wang3, Yingduan Cheng4, Yongsheng Zhang5, Yanyang Tu1,2


Stem Cell‑based Approach in Diabetes and Pancreatic Cancer Management

Yi‑Zhou Jiang1, Demeng Chen2


Mutation Detection with a Liquid Biopsy 96 Mutation Assay in Cancer Patients and Healthy Donors

Aaron Yun Chen, Glenn D. Braunstein, Megan S. Anselmo, Jair A. Jaboni, Fernando Troy Viloria, Julie A. Neidich, Xiang Li, Anja Kammesheidt


The Application of Estrogen Receptor‑1 Mutations’ Detection through Circulating Tumor DNA in Breast Cancer

Binliang Liu, Yalan Yang, Zongbi Yi, Xiuwen Guan, Fei Ma


Circulating MicroRNAs and Long Noncoding RNAs: Liquid Biomarkers in Thoracic Cancers

Pablo Reclusa1, Anna Valentino1, Rafael Sirera1,2, Martin Frederik Dietrich3, Luis Estuardo Raez3, Christian Rolfo1


Exosomes Biology: Function and Clinical Implications in Lung Cancer

Martin Frederik Dietrich1, Christian Rolfo2, Pablo Reclusa2, Marco Giallombardo2, Anna Valentino2, Luis E. Raez1


Circulating Tumor DNA: A Potential Biomarker from Solid Tumors’ Monitor to Anticancer Therapies

Ting Chen1,2, Rongzhang He1,3, Xinglin Hu1,3,4, Weihao Luo1, Zheng Hu1,3, Jia Li1, Lili Duan1, Yali Xie1,2, Wenna Luo1,2, Tan Tan1,2, Di‑Xian Luo1,2


Novel Molecular Multilevel Targeted Antitumor Agents

Poonam Sonawane1, Young A. Choi1, Hetal Pandya2, Denise M. Herpai1, Izabela Fokt3,
Waldemar Priebe3, Waldemar Debinski1


Fish Oil and Prostate Cancer: Effects and Clinical Relevance

Pei Liang, Michael Gao Jr.


Stemness‑related Markers in Cancer

Wenxiu Zhao1, Yvonne Li2, Xun Zhang1


Autophagy Regulated by miRNAs in Colorectal Cancer Progression and Resistance

Andrew Fesler1, Hua Liu1, Ning Wu1,2, Fei Liu3, Peixue Ling3, Jingfang Ju1,3


Gastric Metastases Mimicking Primary Gastric Cancer: A Brief Literature Review

Simona Gurzu1,2,3, Marius Alexandru Beleaua1, Laura Banias2, Ioan Jung1


Possibility of Specific Expression of the Protein Toxins at the Tumor Site with Tumor‑specialized Promoter

Liyuan Zhou1,2, Yujun Li1,2, Changchen Hu3, Binquan Wang1,2


SKI‑178: A Multitargeted Inhibitor of Sphingosine Kinase and Microtubule Dynamics Demonstrating Therapeutic Efficacy in Acute Myeloid Leukemia Models

Jeremy A. Hengst1,2, Taryn E. Dick1,2, Arati Sharma1, Kenichiro Doi3, Shailaja Hegde4, Su‑Fern Tan5, Laura M. Geffert1,2, Todd E. Fox5, Arun K. Sharma1, Dhimant Desai1, Shantu Amin1, Mark Kester5, Thomas P. Loughran5, Robert F. Paulson4, David F. Claxton6, Hong‑Gang Wang3, Jong K. Yun1,2


A T‑cell Engager‑armed Oncolytic Vaccinia Virus to Target the Tumor Stroma

Feng Yu1, Bangxing Hong1, Xiao‑Tong Song1,2,3


Real‑world Experience with Abiraterone in Metastatic Castration‑resistant Prostate Cancer

Yasar Ahmed1, Nemer Osman1, Rizwan Sheikh2, Sarah Picardo1, Geoffrey Watson1


Combination of Interleukin‑11Rα Chimeric Antigen Receptor T‑cells and Programmed Death‑1 Blockade as an Approach to Targeting Osteosarcoma Cells In vitro

Hatel Rana Moonat, Gangxiong Huang, Pooja Dhupkar, Keri Schadler, Nancy Gordon,
Eugenie Kleinerman


Efficacy and Safety of Paclitaxel‑based Therapy and Nonpaclitaxel‑based Therapy in Advanced Gastric Cancer

Tongwei Wu, Xiao Yang, Min An, Wenqin Luo, Danxian Cai, Xiaolong Qi


Motion Estimation of the Liver Based on Deformable Image Registration: A Comparison Between Four‑Dimensional‑Computed Tomography and Four‑Dimensional-Magnetic Resonance Imaging

Xiao Liang1, Fang‑Fang Yin1,2, Yilin Liu1, Brian Czito2, Manisha Palta2, Mustafa Bashir3, Jing Cai1,2


A Feasibility Study of Applying Thermal Imaging to Assist Quality Assurance of High‑Dose Rate Brachytherapy

Xiaofeng Zhu1, Yu Lei1, Dandan Zheng1, Sicong Li1, Vivek Verma1, Mutian Zhang1, Qinghui Zhang1, Xiaoli Tang2, Jun Lian2, Sha X. Chang2, Haijun Song3, Sumin Zhou1, Charles A. Enke1


Role of Exosome microRNA in Breast Cancer

Wang Qu, Ma Fei, Binghe Xu


Recent Progress in Technological Improvement and Biomedical Applications of the Clustered Regularly Interspaced Short Palindromic Repeats/Cas System

Yanlan Li1,2*, Zheng Hu1*, Yufang Yin3, Rongzhang He1, Jian Hu1, Weihao Luo1, Jia Li1, Gebo Wen2, Li Xiao1, Kai Li1, Duanfang Liao4, Di-Xian Luo1,5


The Significance of Nuclear Factor‑Kappa B Signaling Pathway in Glioma: A Review

Xiaoshan Xu1, Hongwei Yang2, Xin Wang2, Yanyang Tu1


Markerless Four‑Dimensional‑Cone Beam Computed Tomography Projection‑Phase Sorting Using Prior Knowledge and Patient Motion Modeling: A Feasibility Study

Lei Zhang1,2, Yawei Zhang2, You Zhang1,2,3, Wendy B. Harris1,2, Fang‑Fang Yin1,2,4, Jing Cai1,4,5, Lei Ren1,2


The Producing Capabilities of Interferon‑g and Interleukin‑10 of Spleen Cells in Primary and Metastasized Oral Squamous Cell Carcinoma Cells-implanted Mice

Yasuka Azuma1,2, Masako Mizuno‑Kamiya3, Eiji Takayama1, Harumi Kawaki1, Toshihiro Inagaki4, Eiichi Chihara2, Yasunori Muramatsu5, Nobuo Kondoh1


“Eating” Cancer Cells by Blocking CD47 Signaling: Cancer Therapy by Targeting the Innate Immune Checkpoint

Yi‑Rong Xiang, Li Liu


Glycosylation is Involved in Malignant Properties of Cancer Cells

Kazunori Hamamura1, Koichi Furukawa2


Biomarkers in Molecular Epidemiology Study of Oral Squamous Cell Carcinoma in the Era of Precision Medicine

Qing‑Hao Zhu1*, Qing‑Chao Shang1*, Zhi‑Hao Hu1*, Yuan Liu2, Bo Li1, Bo Wang1, An‑Hui Wang1


I‑Kappa‑B Kinase‑epsilon Activates Nuclear Factor‑kappa B and STAT5B and Supports Glioblastoma Growth but Amlexanox Shows Little Therapeutic Potential in These Tumors

Nadège Dubois1, Sharon Berendsen2, Aurélie Henry1,2, Minh Nguyen1, Vincent Bours1,
Pierre Alain Robe1,2


Suppressive Effect of Mesenchymal Stromal Cells on Interferon‑g‑Producing Capability of Spleen Cells was Specifically Enhanced through Humoral Mediator(s) from Mouse Oral Squamous Cell Carcinoma Sq‑1979 Cells In Vitro

Toshihiro Inagaki1,2, Masako Mizuno‑Kamiya3, Eiji Takayama1, Harumi Kawaki1, Eiichi Chihara4, Yasunori Muramatsu5, Shinichiro Sumitomo5, Nobuo Kondoh1


An Interplay Between MicroRNA and SOX4 in the Regulation of Epithelial–Mesenchymal Transition and Cancer Progression

Anjali Geethadevi1, Ansul Sharma2, Manish Kumar Sharma3, Deepak Parashar1


MicroRNAs Differentially Expressed in Prostate Cancer of African‑American and European‑American Men

Ernest K. Amankwah


The Role of Reactive Oxygen Species in Screening Anticancer Agents

Xiaohui Xu1, Zilong Dang2, Taoli Sun3, Shengping Zhang1, Hongyan Zhang1


Panobinostat and Its Combination with 3‑Deazaneplanocin‑A Induce Apoptosis and Inhibit In vitro Tumorigenesis and Metastasis in GOS‑3 Glioblastoma Cell Lines

Javier de la Rosa*, Alejandro Urdiciain*, Juan Jesús Aznar‑Morales, Bárbara Meléndez1,
Juan A. Rey2, Miguel A. Idoate3, Javier S. Castresana


Cancer Stem‑Like Cells Have Cisplatin Resistance and miR‑93 Regulate p21 Expression in Breast Cancer

Akiko Sasaki1, Yuko Tsunoda2, Kanji Furuya3, Hideto Oyamada1, Mayumi Tsuji1, Yuko Udaka1, Masahiro Hosonuma1, Haruna Shirako1, Nana Ichimura1, Yuji Kiuchi1


The Contribution of Hexokinase 2 in Glioma

Hui Liu1, Hongwei Yang2, Xin Wang3, Yanyang Tu1


The Mechanism of BMI1 in Regulating Cancer Stemness Maintenance, Metastasis, Chemo‑ and Radiation Resistance

Xiaoshan Xu, Zhen Wang, Nan Liu, Pengxing Zhang, Hui Liu, Jing Qi, Yanyang Tu


A Multisource Adaptive Magnetic Resonance Image Fusion Technique for Versatile Contrast Magnetic Resonance Imaging

Lei Zhang1,2, Fang‑Fang Yin1,2,3, Brittany Moore1,2, Silu Han1,2, Jing Cai1,2,4


Senescence and Cancer

Sulin Zeng1,2, Wen H. Shen2, Li Liu1


The “Wild”‑type Gastrointestinal Stromal Tumors: Heterogeneity on Molecule Characteristics and Clinical Features

Yanhua Mou1, Quan Wang1, Bin Li1,2


Retreatment with Cabazitaxel in a Long‑Surviving Patient with Castration‑Resistant Prostate Cancer and Visceral Metastasis

Raquel Luque Caro, Carmen Sánchez Toro, Lucia Ochoa Vallejo


Therapy‑Induced Histopathological Changes in Breast Cancers: The Changing Role of Pathology in Breast Cancer Diagnosis and Treatment

Shazima Sheereen1, Flora D. Lobo1, Waseemoddin Patel2, Shamama Sheereen3,
Abhishek Singh Nayyar4, Mubeen Khan5


Glioma Research in the Era of Medical Big Data

Feiyifan Wang1, Christopher J. Pirozzi2, Xuejun Li1


Transarterial Embolization for Hepatocellular Adenomas: Case Report and Literature Review

Jian‑Hong Zhong1,2, Kang Chen1, Bhavesh K. Ahir3, Qi Huang4, Ye Wu4, Cheng‑Cheng Liao1, Rong‑Rong Jia1, Bang‑De Xiang1,2, Le‑Qun Li1,2


Nicotinamide Phosphoribosyltransferase: Biology, Role in Cancer, and Novel Drug Target

Antonio Lucena‑Cacace1,2,3, Amancio Carnero1,2


Enhanced Anticancer Effect by Combination of Proteoglucan and Vitamin K3 on Bladder Cancer Cells

Michael Zhang, Kelvin Zheng, Muhammad Choudhury, John Phillips, Sensuke Konno


Molecular Insights Turning Game for Management of Ependymoma: A Review of Literature

Ajay Sasidharan, Rahul Krishnatry


IDH Gene Mutation in Glioma

Leping Liu1, Xuejun Li1,2


Challenges and Advances in the Management of Pediatric Intracranial Germ Cell Tumors: A Case Report and Literature Review

Gerard Cathal Millen1, Karen A. Manias1,2, Andrew C. Peet1,2, Jenny K. Adamski1


Assessing the Feasibility of Using Deformable Registration for Onboard Multimodality‑Based Target Localization in Radiation Therapy

Ge Ren1,2,3, Yawei Zhang1,2, Lei Ren1,2


Research Advancement in the Tumor Biomarker of Hepatocellular Carcinoma

Qing Du1, Xiaoying Ji2, Guangjing Yin3, Dengxian Wei3, Pengcheng Lin1, Yongchang Lu1,
Yugui Li3, Qiaohong Yang4, Shizhu Liu5, Jinliang Ku5, Wenbin Guan6, Yuanzhi Lu7


Novel Insights into the Role of Bacterial Gut Microbiota in Hepatocellular Carcinoma

Lei Zhang1, Guoyu Qiu2, Xiaohui Xu2, Yufeng Zhou3, Ruiming Chang4


Central Odontogenic Fibroma with Unusual Presenting Symptoms

Aanchal Tandon, Bharadwaj Bordoloi, Safia Siddiqui, Rohit Jaiswal


The Prognostic Role of Lactate in Patients Who Achieved Return of Spontaneous Circulation after Cardiac Arrest: A Systematic Review and Meta‑analysis

Dongni Ren1, Xin Wang2, Yanyang Tu1,2


Inhibitory Effect of Hyaluronidase‑4 in a Rat Spinal Cord Hemisection Model

Xipeng Wang1,2, Mitsuteru Yokoyama2, Ping Liu3


Research and Development of Anticancer Agents under the Guidance of Biomarkers

Xiaohui Xu1, Guoyu Qiu1, Lupeng Ji2, Ruiping Ma3, Zilong Dang4, Ruling Jia1, Bo Zhao1


Idiopathic Hypereosinophilic Syndrome and Disseminated Intravascular Coagulation

Mansoor C. Abdulla


Phosphorylation of BRCA1‑Associated Protein 1 as an Important Mechanism in the Evasion of Tumorigenesis: A Perspective

Guru Prasad Sharma1, Anjali Geethadevi2, Jyotsna Mishra3, G. Anupa4, Kapilesh Jadhav5,
K. S. Vikramdeo6, Deepak Parashar2


Progress in Diagnosis and Treatment of Mixed Adenoneuroendocrine Carcinoma of Biliary‑Pancreatic System

Ge Zengzheng1, Huang-Sheng Ling2, Ming-Feng Li2, Xu Xiaoyan1, Yao Kai1, Xu Tongzhen3,
Ge Zengyu4, Li Zhou5


Surface-Enhanced Raman Spectroscopy to Study the Biological Activity of Anticancer Agent

Guoyu Qiu1, Xiaohui Xu1, Lupeng Ji2, Ruiping Ma3, Zilong Dang4, Huan Yang5


Alzheimer’s Disease Susceptibility Genes in Malignant Breast Tumors

Steven Lehrer1, Peter H. Rheinstein2


OSMCC: An Online Survival Analysis Tool for Merkel Cell Carcinoma

Umair Ali Khan Saddozai1, Qiang Wang1, Xiaoxiao Sun1, Yifang Dang1, JiaJia Lv1,2, Junfang Xin1, Wan Zhu3, Yongqiang Li1, Xinying Ji1, Xiangqian Guo1


Protective Activity of Selenium against 5‑Fluorouracil‑Induced Nephrotoxicity in Rats

Elias Adikwu, Nelson Clemente Ebinyo, Beauty Tokoni Amgbare


Advances on the Components of Fibrinolytic System in Malignant Tumors

Zengzheng Ge1, Xiaoyan Xu1, Zengyu Ge2, Shaopeng Zhou3, Xiulin Li1, Kai Yao1, Lan Deng4


A Patient with Persistent Foot Swelling after Ankle Sprain: B‑Cell Lymphoblastic Lymphoma Mimicking Soft‑tissue Sarcoma

Crystal R. Montgomery‑Goecker1, Andrew A. Martin2, Charles F. Timmons3, Dinesh Rakheja3, Veena Rajaram3, Hung S. Luu3


Coenzyme Q10 and Resveratrol Abrogate Paclitaxel‑Induced Hepatotoxicity in Rats

Elias Adikwu, Nelson Clemente Ebinyo, Loritta Wasini Harris


Progress in Clinical Follow‑up Study of Dendritic Cells Combined with Cytokine‑Induced Killer for Stomach Cancer

Ling Wang1,2, Run Wan1,2, Cong Chen1,2, Ruiliang Su1,2, Yumin Li1,2


Supraclavicular Lymphadenopathy as the Initial Manifestation in Carcinoma of Cervix

Priyanka Priyaarshini1, Tapan Kumar Sahoo2


ABO Typing Error Resolution and Transfusion Support in a Case of an Acute Leukemia Patient Showing Loss of Antigen Expression

Debasish Mishra1, Gopal Krushna Ray1, Smita Mahapatra2, Pankaj Parida2


Protein Disulfide Isomerase A3: A Potential Regulatory Factor of Colon Epithelial Cells

Yang Li1, Zhenfan Huang2, Haiping Jiang3


Clinicopathological Association of p16 and its Impact on Outcome of Chemoradiation in Head‑and‑Neck Squamous Cell Cancer Patients in North‑East India

Srigopal Mohanty1, Yumkhaibam Sobita Devi2, Nithin Raj Daniel3, Dulasi Raman Ponna4,
Ph. Madhubala Devi5, Laishram Jaichand Singh2


Potential Inhibitor for 2019‑Novel Coronaviruses in Drug Development

Xiaohui Xu1, Zilong Dang2, Lei Zhang3, Lingxue Zhuang4, Wutang Jing5, Lupeng Ji6, Guoyu Qiu1


Best‑Match Blood Transfusion in Pediatric Patients with Mixed Autoantibodies

Debasish Mishra1, Dibyajyoti Sahoo1, Smita Mahapatra2, Ashutosh Panigrahi3


Characteristics and Outcome of Patients with Pheochromocytoma

Nadeema Rafiq1, Tauseef Nabi2, Sajad Ahmad Dar3, Shahnawaz Rasool4


Comparison of Histopathological Grading and Staging of Breast Cancer with p53‑Positive and Transforming Growth Factor‑Beta Receptor 2‑Negative Immunohistochemical Marker Expression Cases

Palash Kumar Mandal1, Anindya Adhikari2, Subir Biswas3, Amita Giri4, Arnab Gupta5,
Arindam Bhattacharya6


Chemical Compositions and Antiproliferative Effect of Essential Oil of Asafoetida on MCF7 Human Breast Cancer Cell Line and Female Wistar Rats

Seyyed Majid Bagheri1,2, Davood Javidmehr3, Mohammad Ghaffari1, Ehsan Ghoderti‑Shatori4


Cyclooxygenase‑2 Contributes to Mutant Epidermal Growth Factor Receptor Lung Tumorigenesis by Promoting an Immunosuppressive Environment

Mun Kyoung Kim1, Aidin Iravani2, Matthew K. Topham2,3


Cuproptosis-related Genes in Glioblastoma as Potential Therapeutic Targets

Zhiyu Xia1,2, Haotian Tian1, Lei Shu1,2, Guozhang Tang3, Zhenyu Han4, Yangchun Hu1*, Xingliang Dai1*


Cancer Diagnosis and Treatments by Porous Inorganic Nanocarriers

Jianfeng Xu1,2, Hanwen Zhang1,2, Xiaohui Song1,2, Yangong Zheng3, Qingning Li1,2,4*


Delayed (20 Years) post-surgical Esophageal Metastasis of Breast Cancer - A Case Report

Bowen Hu1#, Lingyu Du2#, Hongya Xie1, Jun Ma1, Yong Yang1*, Jie Tan2*


Subtyping of Undifferentiated Pleomorphic Sarcoma and Its Clinical Meaning

Umair Ali Khan Saddozai, Zhendong Lu, Fengling Wang, Muhammad Usman Akbar, Saadullah Khattak, Muhammad Badar, Nazeer Hussain Khan, Longxiang Xie, Yongqiang Li, Xinying Ji, Xiangqian Guo


Construction of Glioma Prognosis Model and Exploration of Related Regulatory Mechanism of Model Gene

Suxia Hu, Abdusemer Reyimu, Wubi Zhou, Xiang Wang, Ying Zheng, Xia Chen, Weiqiang Li, Jingjing Dai


ESRP2 as a Non-independent Potential Biomarker-Current Progress in Tumors

Yuting Chen, Yuzhen Rao, Zhiyu Zeng, Jiajie Luo, Chengkuan Zhao, Shuyao Zhang


Resection of Bladder Tumors at the Ureteral Orifice Using a Hook Plasma Electrode: A Case Report

Jun Li, Ziyong Wang, Qilin Wang


Structural Characterization and Bioactivity for Lycium Barbarum Polysaccharides

Jinghua Qi1,2,  Hangping Chen3,Huaqing Lin2,4,Hongyuan Chen1,2,5* and Wen Rui2,3,5,6*


The Role of IL-22 in the Prevention of Inflammatory Bowel Disease and Liver Injury

Xingli Qi1,2, Huaqing Lin2,3, Wen Rui2,3,4,5 and Hongyuan Chen1,2,3


RBM15 and YTHDF3 as Positive Prognostic Predictors in ESCC: A Bioinformatic Analysis Based on The Cancer Genome Atlas (TCGA)

Yulou Luo1, Lan Chen2, Ximing Qu3, Na Yi3, Jihua Ran4, Yan Chen3,5*


Mining and Analysis of Adverse Drug Reaction Signals Induced by Anaplastic Lymphoma Kinase-Tyrosine Kinase Inhibitors Based on the FAERS Database

Xiumin Zhang1,2#, Xinyue Lin1,3#, Siman Su1,3#, Wei He3, Yuying Huang4, Chengkuan Zhao3, Xiaoshan Chen3, Jialin Zhong3, Chong Liu3, Wang Chen3, Chengcheng Xu3, Ping Yang5, Man Zhang5, Yanli Lei5*, Shuyao Zhang1,3*


Advancements in Immunotherapy for Advanced Gastric Cancer

Min Jiang1#, Rui Zheng1#, Ling Shao1, Ning Yao2, Zhengmao Lu1*


Tumor Regression after COVID-19 Infection in Metastatic Adrenocortical Carcinoma Treated with Immune Checkpoint Blockade: A Case Report

Qiaoxin Lin1, Bin Liang1, Yangyang Li2, Ling Tian3*, Dianna Gu1*


Mining and Analysis of Adverse Events of BRAF Inhibitors Based on FDA Reporting System

Silan Peng1,2#, Danling Zheng1,3#, Yanli Lei4#, Wang Chen3, Chengkuan Zhao3, Xinyue Lin1, Xiaoshan Chen3, Wei He3, Li Li3, Qiuzhen Zhang5*, Shuyao Zhang1,3*


Malignant Phyllodes Tumor with Fever, Anemia, Hypoproteinemia: A Rare and Strange Case Report and Literature Review

Zhenghang Li1, Yuxian Wei1*


Construction of Cuproptosis-Related LncRNA Signature as a Prognostic Model Associated with Immune Microenvironment for Clear-Cell Renal Cell Carcinoma

Jiyao Yu1#, Shukai Zhang2#, Qingwen Ran3, Xuemei Li4,5,6*


PlaSciPub - Platform for Scientific Publications

Copyrights © 2021 - 2022 | Plascipub | All Rights Reserved